Stem-loop sequence vvi-MIR398b

AccessionMI0007958 (change log)
DescriptionVitis vinifera miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

4 open access papers mention vvi-MIR398b
(12 sentences)

Stem-loop
   --gu    ua    u            u      ccc   ccac 
5'     gucc  cagg gugaccugagaa cacaug   gca    c
       ||||  |||| |||||||||||| ||||||   |||    c
3'     cagg  gucc cgcuggacucuu guguac   cgu    a
   cccu    uc    c            -      ucu   uucu 
Get sequence
Deep sequencing
408 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr6: 16503544-16503631 [-]
intergenic
Database links

Mature sequence vvi-miR398b

Accession MIMAT0006563
Sequence

58 - 

uguguucucaggucgccccug

 - 78

Get sequence
Deep sequencing400 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).