miRBase entry: vvi-MIR403b

Stem-loop vvi-MIR403b


Accession
MI0007965
Description
Vitis vinifera vvi-MIR403b precursor miRNA
Gene family
MIPF0000290; MIR403

Literature search
2 open access papers mention vvi-MIR403b
(5 sentences)

Sequence

321 reads, 22 reads per million, 2 experiments
acaaaccucgaguuugugcgcgaauccaacgccucgaucuucuuucaaaggggugUUAGAUUCACGCACAAACUCGggaucugucu
......((((((((((((((.(((((.((((((((..............)))))))).))))).))))))))))))))........

Structure
--acaaac              c     c        gaucuu 
        cucgaguuugugcg gaauc aacgccuc      c
        |||||||||||||| ||||| ||||||||       
        ggGCUCAAACACGC CUUAG UUgugggg      u
ucugucua              A     A        aaacuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 600181-600266 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR403b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR403b

Accession MIMAT0006570
Description Vitis vinifera vvi-miR403b mature miRNA
Sequence 56 - UUAGAUUCACGCACAAACUCG - 76
Evidence experimental
Array [2], Illumina [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558