Stem-loop sequence vvi-MIR403f

AccessionMI0007969 (change log)
DescriptionVitis vinifera miR403f stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention vvi-MIR403f
(5 sentences)

Stem-loop
   --ug    g g              c     aaccgccugaucuaaaccuuuuc 
5'     agau a gaguuugugcguga ucuaa                       c
       |||| | |||||||||||||| |||||                        
3'     ucua u cucaaacacgcacu agauu                       c
   ucug    a g              u     cugguaucuuuuccauagcguag 
Get sequence
Deep sequencing
332 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 4179673-4179780 [-]
intergenic
Database links

Mature sequence vvi-miR403f

Accession MIMAT0006574
Sequence

78 - 

uuagauucacgcacaaacucg

 - 98

Get sequence
Deep sequencing332 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).