Stem-loop sequence vvi-MIR845a

AccessionMI0007974 (change log)
DescriptionVitis vinifera miR845a stem-loop
Gene family MIPF0000543; MIR845_3
Literature search

4 open access papers mention vvi-MIR845a
(7 sentences)

Stem-loop
   uuucacuugauuaguuccuucaugaguuauugcaaguaaucuccaaauuuccuuagcggauuuacauugacauauucuauuauauucauuccuauccauagcacauugcaaaguaaaaac     uag       -uu      uu  --            auuccauucuugcuuggguuuuggaaccaaaauuccaucaacuaauuuaguggguaaaguugggccaucuucaauggcaucccauacaucuaaauca 
5'                                                                                                                         gacuu   cauuuaa   gaaaau  cu  ucuaucaagcuc                                                                                                 g
                                                                                                                           |||||   |||||||   ||||||  ||  ||||||||||||                                                                                                  
3'                                                                                                                         cugaa   guagauu   cuuuua  ga  agguaguucgag                                                                                                 u
   ---------------------------------------------------------------------------cggaaacaaaauaguuaaccauagucucgaucuggagaacgaauu     uua       cuc      cc  ua            uagaguuugacuuuuaacaaguuuuguaucucgagguaagaaaugcccuuggcugauagggauaaccuuucgaucuuacugaaccaugaauguuagu 
Get sequence
Deep sequencing
406 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr16: 20504749-20505190 [+]
intergenic
Database links

Mature sequence vvi-miR845a

Accession MIMAT0006579
Sequence

412 - 

uagcucugauaccaauugaua

 - 432

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence by similarity; MI0001706

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).