Stem-loop sequence vvi-MIR845b

AccessionMI0007975 (change log)
DescriptionVitis vinifera miR845b stem-loop
Gene family MIPF0000543; MIR845_3
Literature search

4 open access papers mention vvi-MIR845b
(7 sentences)

Stem-loop
   uuucacuugauuaguuccuucaugaguuauuucaagcaaucuccaaauuuccuuagcagauuuacauuggcauauucuauuauauucauuccuauccauagcacauugcaaaguaaaaac     uag       -uu      --  c             auuccauucuugcuugaguuuuggaaccaaaacuccaucaacuaauuuagugggaaaaguugggccaucuucaaugacaucccauacaucuaaauca 
5'                                                                                                                         gacuu   cauuuaa   gaaaau  uu uucuaucaagcuc                                                                                                 g
                                                                                                                           |||||   |||||||   ||||||  || |||||||||||||                                                                                                  
3'                                                                                                                         cugaa   guagauu   cuuuua  aa aagguaguucgag                                                                                                 u
   ---------------------------------------------------------------------------cggaaacaaaauaguuaaccauagucucgaucuggagaacgaauu     uua       cuc      cc  c             uagaguuugacuuuuaacaaguuuuguaucucgagguaagaaaugcccuuggcugauagggauaaccuuucaaucuuacugaaccaugaauguuagu 
Get sequence
Deep sequencing
389 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr2: 12264843-12265284 [+]
intergenic
Database links

Mature sequence vvi-miR845b

Accession MIMAT0006580
Sequence

412 - 

uagcucugauaccaauugaua

 - 432

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence by similarity; MI0001704

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).