Stem-loop sequence vvi-MIR845c

AccessionMI0007976 (change log)
DescriptionVitis vinifera miR845c stem-loop
Literature search

4 open access papers mention vvi-MIR845c
(7 sentences)

Stem-loop
   --caa         --     u   u            ggc    uc 
5'      uuauguguu  uuggu guc gaguuucauguu   aauu  u
        |||||||||  ||||| ||| ||||||||||||   ||||  u
3'      aauacguag  aacca uag cucggaguacaa   uuag  a
   uacca         uu     -   u            --a    ua 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 207778-207867 [-]
intergenic
Database links

Mature sequence vvi-miR845c

Accession MIMAT0006581
Sequence

60 - 

aggcucugauaccaauugaug

 - 80

Get sequence
Deep sequencing35 reads, 2 experiments
Evidence by similarity; MI0005385

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).