Stem-loop sequence vvi-MIR845d

AccessionMI0007977 (change log)
DescriptionVitis vinifera miR845d stem-loop
Gene family MIPF0000481; MIR845_2
Literature search

4 open access papers mention vvi-MIR845d
(7 sentences)

Stem-loop
   ----auaa  aa        auccc            auaaacaaaaacuc   -aa     ag    ca 
5'         cc  cauuaauu     uagggccauggg              ugc   aacca  uuag  c
           ||  ||||||||     ||||||||||||              |||   |||||  ||||   
3'         gg  guaguuaa     gucucgguaucc              acg   uuggu  gauc  a
   uccaaaaa  --        ccaua            ----aaucauuaac   auc     aa    cc 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr4: 9870404-9870534 [-]
intergenic
Database links

Mature sequence vvi-miR845d

Accession MIMAT0006582
Sequence

101 - 

uggcucugauaccaauugaug

 - 121

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence by similarity; MI0005385

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).