Stem-loop sequence vvi-MIR845e

AccessionMI0007978 (change log)
DescriptionVitis vinifera miR845e stem-loop
Gene family MIPF0000481; MIR845_2
Literature search

4 open access papers mention vvi-MIR845e
(7 sentences)

Stem-loop
   --agaacgca        auccc            auaaacaaaaaccuugaaaaaacaaguuag 
5'           cauuaauu     uagggccauggg                              c
             ||||||||     ||||||||||||                              a
3'           guaguuaa     gucucgguaucc                              c
   cucaaaaagg        ccaua            aaucauuagcacgaucuugguaagauccca 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr5: 13374677-13374807 [+]
intergenic
Database links

Mature sequence vvi-miR845e

Accession MIMAT0006583
Sequence

101 - 

uggcucugauaccaauugaug

 - 121

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence by similarity; MI0000203

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).