Stem-loop sequence cfa-let-7a-1

AccessionMI0007989 (change log)
Previous IDscfa-let-7a
DescriptionCanis familiaris let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   gu               --- ug    ucu 
5'    gag  aguagguuguauagu   u  gggc   g
      |||  |||||||||||||||   |  ||||    
3'    uuc  ucaucuaacauauca   g  cucg   c
   ccu   ug               aug gu    ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr10: 20034319-20034387 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-let-7a-1
cfa-let-7a-1chr10: 20034319-20034387 [-]
cfa-let-7bchr10: 20033388-20033472 [-]
Database links

Mature sequence cfa-let-7a

Accession MIMAT0006594
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence by similarity; MI0000557
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).