Stem-loop sequence cfa-mir-99b

AccessionMI0008003 (change log)
DescriptionCanis familiaris miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --c         ac   c    c - -   c 
5'    acccguaga  cga cuug g g ggc u
      |||||||||  ||| |||| | | |||  
3'    ugggugucu  gcu gaac c c ccg u
   guc         ga   c    a a g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 105400925-105400984 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-99b
cfa-mir-99bchr1: 105400925-105400984 [-]
cfa-let-7echr1: 105400740-105400806 [-]
cfa-mir-125achr1: 105400273-105400332 [-]
Database links

Mature sequence cfa-miR-99b

Accession MIMAT0006607
Sequence

1 - 

cacccguagaaccgaccuugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).