Stem-loop sequence cfa-let-7e

AccessionMI0008004 (change log)
DescriptionCanis familiaris let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   g                u  ----g a  a 
5'    gag uaggagguuguauagu ga     g gg c
      ||| |||||||||||||||| ||     | ||  
3'    uuc auccuccggcauauca cu     c cc a
   ccu   g                -  agagg a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 105400740-105400806 [-]
sense
ENSCAFT00000032552 ; cfa-let-7e-201; exon 1
Clustered miRNAs
< 10kb from cfa-let-7e
cfa-mir-99bchr1: 105400925-105400984 [-]
cfa-let-7echr1: 105400740-105400806 [-]
cfa-mir-125achr1: 105400273-105400332 [-]
Database links

Mature sequence cfa-let-7e

Accession MIMAT0006608
Sequence

1 - 

ugagguaggagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).