Stem-loop sequence cfa-mir-125a

AccessionMI0008005 (change log)
DescriptionCanis familiaris miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --uc  ug   c    ua        ----  a 
5'     cc  aga ccuu  accuguga    gg c
       ||  ||| ||||  ||||||||    ||  
3'     gg  ucu ggag  uggacacu    cc a
   ccga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 105400273-105400332 [-]
sense
ENSCAFT00000039982 ; cfa-mir-125a-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-125a
cfa-mir-99bchr1: 105400925-105400984 [-]
cfa-let-7echr1: 105400740-105400806 [-]
cfa-mir-125achr1: 105400273-105400332 [-]
Database links

Mature sequence cfa-miR-125a

Accession MIMAT0006609
Sequence

1 - 

ucccugagacccuuuaaccugu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).