Stem-loop sequence cfa-let-7f

AccessionMI0008006 (change log)
DescriptionCanis familiaris let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u                       ---------       u 
5'    gagguaguagauuguauaguugu         gggguag g
      |||||||||||||||||||||||         ||||||| a
3'    uuccguuaucuaacauaucaaua         ucccauu u
   ccc                       gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 97903931-97904008 [-]
sense
ENSCAFT00000032642 ; cfa-let-7f-201; exon 1
Clustered miRNAs
< 10kb from cfa-let-7f
cfa-let-7fchr1: 97903931-97904008 [-]
cfa-let-7dchr1: 97902012-97902136 [-]
Database links

Mature sequence cfa-let-7f

Accession MIMAT0006610
Sequence

1 - 

ugagguaguagauuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).