Stem-loop sequence cfa-let-7g

AccessionMI0008036 (change log)
DescriptionCanis familiaris let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u        a            ugagg    -a  a    a 
5'    gagguagu guuuguacaguu     gucu  ug uacc c
      |||||||| ||||||||||||     ||||  || ||||  
3'    uuccguca cggacaugucaa     uaga  ac augg c
   ccg        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 37501074-37501152 [+]
sense
ENSCAFT00000032716 ; cfa-let-7g-201; exon 1
ENSCAFT00000015643 ; WDR82-201; intron 2
Database links

Mature sequence cfa-let-7g

Accession MIMAT0006637
Sequence

1 - 

ugagguaguaguuuguacaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).