Stem-loop sequence cfa-mir-99a-1

AccessionMI0008075 (change log)
DescriptionCanis familiaris miR-99a-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --a         uc   u      g  aa 
5'    acccguaga  cga cuugug ug  g
      |||||||||  ||| |||||| ||  u
3'    uggguaucu  gcu gaacac gc  g
   guc         uc   c      g  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr31: 13258782-13258840 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-99a-1
cfa-mir-99a-1chr31: 13258782-13258840 [+]
cfa-let-7cchr31: 13259522-13259588 [+]
Database links

Mature sequence cfa-miR-99a

Accession MIMAT0006668
Sequence

1 - 

aacccguagauccgaucuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).