Stem-loop sequence cfa-let-7c

AccessionMI0008076 (change log)
DescriptionCanis familiaris let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   g   u             ua  g ua a 
5'    gag uag agguuguaugguu  ga u  c c
      ||| ||| |||||||||||||  || |  | c
3'    uuc auc uccaacaugucaa  uu a  g c
   ccu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr31: 13259522-13259588 [+]
sense
ENSCAFT00000032603 ; cfa-let-7c-201; exon 1
Clustered miRNAs
< 10kb from cfa-let-7c
cfa-mir-99a-1chr31: 13258782-13258840 [+]
cfa-let-7cchr31: 13259522-13259588 [+]
Database links

Mature sequence cfa-let-7c

Accession MIMAT0006669
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).