Stem-loop sequence cfa-mir-194

Accession MI0008091
Description Canis familiaris miR-194 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--u         a     -  ug     u 
   guaacagca cucca ug  gauug g
   ||||||||| ||||| ||  ||||| u
   cauugucgu gaggu ac  uuaac g
uuu         a     g  cu     c 
Get sequence
Genome context
Coordinates (CanFam2) Overlapping transcripts
chr38: 17895067-17895124 [-]
antisense
ENSCAFT00000017536 ; XM_536121.2; intron 13
Clustered miRNAs
< 10kb from cfa-mir-194
cfa-mir-194 chr38: 17895067-17895124 [-]
cfa-mir-215 chr38: 17894774-17894852 [-]

Mature sequence cfa-miR-194

Accession MIMAT0006681
Sequence

1 - 

uguaacagcaacuccaugugga

 - 22

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).