Stem-loop sequence cfa-mir-142

AccessionMI0008160 (change log)
DescriptionCanis familiaris miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   --c           a         uaa ag a 
5'    ccauaaaguag aagcacuac   c  c c
      ||||||||||| |||||||||   |  |  
3'    gguauuucauc uuugugaug   g  g u
   gua           c         -ug ga g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 32977393-32977455 [-]
sense
ENSCAFT00000032733 ; cfa-mir-142-201; exon 1
Database links

Mature sequence cfa-miR-142

Accession MIMAT0006736
Sequence

1 - 

cccauaaaguagaaagcacua

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).