Stem-loop sequence gga-mir-214

Accession MI0008208
Description Gallus gallus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-214 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ggacu      acgga           u          aca            aacau 
     ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
     ccgacc     caacaguacac gacggacaga   ggacgacauguc     u
----u      -----           u          cac            cacuc 
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr8: 4627233-4627342 [+]
sense
antisense
ENSGALT00000005010 ; F1NQQ1_CHICK; intron 20
Clustered miRNAs
< 10kb from gga-mir-214
gga-mir-199-2 chr8: 4621376-4621483 [+]
gga-mir-214 chr8: 4627233-4627342 [+]
Database links

Mature sequence gga-miR-214

Accession MIMAT0007751
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).