Stem-loop sequence osa-MIR1874

AccessionMI0008277 (change log)
DescriptionOryza sativa miR1874 stem-loop
Literature search

8 open access papers mention osa-MIR1874
(38 sentences)

Stem-loop 
   -cc             a   caguggu    a   a   c   u  -a         a   -     aucuucga       a 
5'    auaaucaucuauu gua       gaag cau ggg uac ac  ccauccaua ggg uucga        ugugccu g
      ||||||||||||| |||       |||| ||| ||| ||| ||  ||||||||| ||| |||||        ||||||| a
3'    uauugguagauaa cau       uuuc gua ccc aug ug  gguagguau ccc agguu        acauggg u
   uuu             a   -------    c   g   a   -  ga         a   u     -------g       a
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 8702798-8702948 [-]
intergenic
Database links

Mature sequence osa-miR1874-5p

Accession MIMAT0007827
Sequence

34 -  

uagggcuacuacaccauccauaag

 - 57

Get sequence
Evidence experimental; 454 [1], Illumina [3]

Mature sequence osa-miR1874-3p

Accession MIMAT0007828
Sequence

103 -  

uauggauggagguguaacccgaug

 - 126

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1], cloned [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
3
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).