Stem-loop sequence osa-MIR1862d

Accession

MI0008279 (change log)

Description

Oryza sativa miR1862d stem-loop

Gene family

MIPF0000580; MIR1862

Literature search

15 open access papers mention osa-MIR1862d
(24 sentences)

Stem-loop

   cuac       ucuc     uu    -                             g           augu  c 
5'     uggcuag    guagc  gcua gguacucccucugucccaaaauaaacaaa cuaguacgggg    gg a
       |||||||    |||||  |||| ||||||||||||||||||||||||||||| |||||||||||    || c
3'     auugguc    cauug  ugau cuaugagggaggcaggguuuuauuuguuu gaucauguccu    cc u
   -auc       uccu     uu    a                             g           -gau  u 

Deep sequencing

6716 reads, 3.35e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr10: 4833611-4833760 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR1862d

• osa-MIR1876: Chr10: 4833365-4833521 [+]
• osa-MIR1862d: Chr10: 4833611-4833760 [+]

Database links

• miRBase Tracker:MI0008279

Mature sequence osa-miR1862d

• Accession: MIMAT0007830
• Sequence: 90 - acuagguuuguuuauuuugggacg - 113
• Deep sequencing: 6352 reads, 2 experiments
• Evidence: experimental; 454 [1]
• Database links:
  • RNAcentral:URS000014BC6E_39947

References

1. PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).