Stem-loop sequence aga-mir-11

AccessionMI0008306 (change log)
DescriptionAnopheles gambiae miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

3 open access papers mention aga-mir-11
(6 sentences)

Stem-loop
   g    c          ug  a       cugugugguuauuagc 
5'  cauc ggcaagaacu  ga cugugau                c
    |||| ||||||||||  || |||||||                g
3'  guag ucguucuuga  cu gacacua                c
   g    c          gu  -       cacuucucgaagcuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 13042022-13042111 [+]
intergenic
Clustered miRNAs
< 10kb from aga-mir-11
aga-mir-11chr2R: 13042022-13042111 [+]
aga-mir-998chr2R: 13042402-13042472 [+]
Database links

Mature sequence aga-miR-11

Accession MIMAT0007856
Sequence

63 - 

caucacagucugaguucuugcu

 - 84

Get sequence
Evidence not experimental

References

1