Stem-loop sequence aga-mir-981

AccessionMI0008307 (change log)
DescriptionAnopheles gambiae miR-981 stem-loop
Gene family MIPF0000710; mir-981
Literature search

3 open access papers mention aga-mir-981
(5 sentences)

Stem-loop
         -    gau         c    u    u    ----------   ga 
5' gccuua ucug   cggguuucg uggc aacg guug          ugc  g
   |||||| ||||   ||||||||| |||| |||| ||||          |||   
3' cggaau aggc   guccaaagc gcug uugc uaac          acg  c
         g    -ac         a    -    u    uucaaaaaaa   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chrX: 1228287-1228381 [+]
intergenic
Database links

Mature sequence aga-miR-981

Accession MIMAT0007857
Sequence

63 - 

uucguugucgacgaaaccug

 - 82

Get sequence
Evidence not experimental

References

1