Stem-loop sequence aga-mir-375

AccessionMI0008310 (change log)
Previous IDsaga-mir-375-1
DescriptionAnopheles gambiae miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

4 open access papers mention aga-mir-375
(5 sentences)

Stem-loop
   u        gagac     uu g  u   ua     c   u     aa     ua 
5'  guugcgau     agaau  g au acu  agcca gcg acaga  cuuuu  g
    ||||||||     |||||  | || |||  ||||| ||| |||||  |||||   
3'  cgacguua     ucuug  c ua uga  ucggu ugc uguuu  gaaag  a
   a        ---aa     gc g  u   gc     u   u     ga     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 51640560-51640668 [-]
intergenic
Database links

Mature sequence aga-miR-375

Accession MIMAT0007860
Sequence

67 - 

uuuguucguuuggcucgaguua

 - 88

Get sequence
Evidence not experimental

References

1