Stem-loop sequence mmu-mir-1903

AccessionMI0008317 (change log)
Symbol MGI:Mir1903
DescriptionMus musculus miR-1903 stem-loop
Literature search

1 open access papers mention mmu-mir-1903
(2 sentences)

Stem-loop
   --         u -   c          -u   a   g  c 
5'   uuuuuuucc c cuu uucuucuucc  gag cau gc c
     ||||||||| | ||| ||||||||||  ||| ||| ||  
3'   ggaaaaggg g gaa aaggagaagg  cuc gug cg g
   ag         u u   c          uc   g   a  g 
Get sequence
Deep sequencing
75 reads, 741 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 128359241-128359320 [+]
sense
ENSMUST00000026917 ; Nrp1-201; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-1903

Accession MIMAT0007868
Sequence

11 - 

ccuucuucuucuuccugagaca

 - 32

Get sequence
Deep sequencing25 reads, 16 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).