![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-2a-1 |
||||||||||||
Accession | MI0008338 (change log) | |||||||||||
Description | Bombyx mori miR-2a-1 stem-loop | |||||||||||
Gene family | MIPF0000049; mir-2 | |||||||||||
Literature search |
![]()
11 open access papers mention bmo-mir-2a-1 | |||||||||||
Stem-loop |
g a u -g c u c gucau 5' gcgga ug agucgug caucaaagu gguu gu auag a ||||| || ||||||| ||||||||| |||| || |||| 3' ugucu ac ucagcac guaguuucg ccga ca uauc a - - u ga a - c aaugc |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence bmo-miR-2a-1-5p |
|
Accession | MIMAT0015271 |
Previous IDs | bmo-miR-2a-1* |
Sequence |
18 - gcaucaaagucgguuugucaua - 39 |
Deep sequencing | 664 reads, 3 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Mature sequence bmo-miR-2a-3p |
|
Accession | MIMAT0007894 |
Previous IDs | bmo-miR-2a |
Sequence |
54 - uaucacagccagcuuugaugagc - 76 |
Deep sequencing | 3311 reads, 3 experiments |
Evidence | experimental; Northern [1], RT-PCR [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
2 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|