Stem-loop sequence bmo-mir-87

Accession MI0008344
Description Bombyx mori miR-87 stem-loop
Gene family MIPF0000152; mir-87
Stem-loop 
---u  aga   u   ua        g       ucg      ag     uauu 
    ga   agu cgg  cacuaaug gccugaa   uugcuc  accug    u
    ||   ||| |||  |||||||| |||||||   ||||||  |||||     
    cu   ucg gcc  gugauugu uggacuu   aacgag  uggac    u
acau  -gg   -   --        g       uca      --     cagc
Get sequence
Deep sequencing
157 reads, 3 experiments
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2800: 298533-298633 [+]
intergenic

Mature sequence bmo-miR-87

Accession MIMAT0007900
Sequence

62 -  

ugagcaaacuuucaggugugu

 - 82

Get sequence
Deep sequencing 156 reads, 3 experiments
Evidence experimental; RT-PCR [2], Solexa [3]

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).