Stem-loop sequence bmo-bantam

AccessionMI0008350 (change log)
DescriptionBombyx mori bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

12 open access papers mention bmo-bantam
(40 sentences)

Stem-loop
   uaaa      uac    c                  ga    u  u 
5'     aggaac   gaaa ugguuuucauaaugauuu  caga ug u
       ||||||   |||| ||||||||||||||||||  |||| || u
3'     uccuug   uuuu aucgaaaguguuacuaga  gucu au u
   augg      ---    a                  --    u  g 
Get sequence
Deep sequencing
13553 reads, 2.13e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582023.1: 2305314-2305403 [+]
intergenic
Database links

Mature sequence bmo-bantam-5p

Accession MIMAT0015278
Previous IDsbmo-bantam*
Sequence

18 - 

cugguuuucauaaugauuugaca

 - 40

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence bmo-bantam-3p

Accession MIMAT0007907
Previous IDsbmo-bantam
Sequence

56 - 

ugagaucauugugaaagcuaauu

 - 78

Get sequence
Deep sequencing13541 reads, 3 experiments
Evidence experimental; Northern [1], RT-PCR [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).