Stem-loop sequence sly-MIR160a

AccessionMI0008357 (change log)
DescriptionSolanum lycopersicum miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

26 open access papers mention sly-MIR160a
(106 sentences)

Stem-loop
   -caa            -------u      c       cu            -   a     c  uaa 
5'     gucguguacacg        auaugc uggcucc  guaugccauuug caa gcuca cg   u
       ||||||||||||        |||||| |||||||  |||||||||||| ||| ||||| ||    
3'     uaguauaugugc        uauacg accgagg  uaugcgguaagu guu cgggu gc   a
   guug            uauagccu      a       ag            u   c     a  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr5: 65436314-65436442 [-]
intergenic
Database links

Mature sequence sly-miR160a

Accession MIMAT0007914
Sequence

20 - 

ugccuggcucccuguaugcca

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).