Stem-loop sequence sly-MIR166b

AccessionMI0008359 (change log)
DescriptionSolanum lycopersicum miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

25 open access papers mention sly-MIR166b
(90 sentences)

Stem-loop
       a   aucaua       a  ucucu      a        uu      cu   g u   c   --ua   c          --a     -accaug     c 
5' uccc uag      uggagga gu     caguug ggggaaug  gucugg  cga g cac aau    gau cauaaucccu   uauau       cuuuu a
   |||| |||      ||||||| ||     |||||| ||||||||  ||||||  ||| | ||| |||    ||| ||||||||||   |||||       ||||| a
3' aggg auc      aucuccu ca     guuaac ccccuuac  cggacc  gcu u gug uug    cua guauugggga   guaua       gaaaa a
       g   -----g       -  ---uu      c        uu      ag   g u   a   ugua   a          aaa     auauuua     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 65694593-65694793 [+]
intergenic
Database links

Mature sequence sly-miR166b

Accession MIMAT0007916
Sequence

154 - 

ucggaccaggcuucauucccc

 - 174

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).