Stem-loop sequence sly-MIR167a

AccessionMI0008360 (change log)
Previous IDssly-MIR167
DescriptionSolanum lycopersicum miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

24 open access papers mention sly-MIR167a
(222 sentences)

Stem-loop
        -ca   c ag   u   a       g        aaa        uu    ca 
5' ucgug   gca u  cag uga gcugcca caugaucu   cuuuccuu  aguu  a
   |||||   ||| |  ||| ||| ||||||| ||||||||   ||||||||  ||||  a
3' agcac   cgu a  guc auu cgacggu guacuaga   gaaaggag  uuaa  u
        uac   a cu   c   c       -        cua        -c    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 49339356-49339471 [-]
intergenic
Database links

Mature sequence sly-miR167a

Accession MIMAT0007917
Previous IDssly-miR167
Sequence

19 - 

ugaagcugccagcaugaucua

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).