|
miRBase |
|
Stem-loop sequence sly-MIR167 |
|||||
| Accession | MI0008360 | ||||
| Description | Solanum lycopersicum miR167 stem-loop | ||||
| Gene family | MIPF0000023; MIR167_1 | ||||
| Stem-loop |
-ca c ag u a g aaa uu ca ucgug gca u cag uga gcugcca caugaucu cuuuccuu aguu a ||||| ||| | ||| ||| ||||||| |||||||| |||||||| |||| a agcac cgu a guc auu cgacggu guacuaga gaaaggag uuaa u uac a cu c c - cua -c ua |
||||
| Genome context |
|
||||
Mature sequence sly-miR167 |
|
| Accession | MIMAT0007917 |
| Sequence |
19 - ugaagcugccagcaugaucua - 39 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:18653800
"Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"
Genome Res. 18:1602-1609(2008).
|
| 2 |
PMID:18602455
"Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"
Gene. 423:1-7(2008).
|