Stem-loop sequence sly-MIR169a

AccessionMI0008361 (change log)
DescriptionSolanum lycopersicum miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

17 open access papers mention sly-MIR169a
(51 sentences)

Stem-loop
         -ua   uuu      a uu         c  g   c         ug          c --a     ug 
5' ggucua   agg   gcauga g  gaagagagu aa uug agccaagga  acuugccgga c   aaagu  u
   ||||||   |||   |||||| |  ||||||||| || ||| |||||||||  |||||||||| |   |||||  g
3' ccagau   ucc   uguacu c  cuucucucg uu aau ucgguuuuu  ugaacggccu g   uuuua  a
         ugc   uau      - uu         u  g   a         gu          u auc     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 4225343-4225491 [+]
intergenic
Clustered miRNAs
< 10kb from sly-MIR169a
sly-MIR169achr7: 4225343-4225491 [+]
sly-MIR5302bchr7: 4228975-4229187 [+]
Database links

Mature sequence sly-miR169a

Accession MIMAT0007918
Sequence

41 - 

cagccaaggaugacuugccgg

 - 61

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).