Stem-loop sequence sly-MIR171d

AccessionMI0008368 (change log)
DescriptionSolanum lycopersicum miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

23 open access papers mention sly-MIR171d
(135 sentences)

Stem-loop
        ---------     c          a         c  a  -  -aa      cuu 
5' augga         agaag gauguuggug gguucaauc ga ga cg   uuuaug   a
   |||||         ||||| |||||||||| ||||||||| || || ||   ||||||    
3' ugccu         ucuuc cuauaaccgc ccgaguuag cu cu gc   aaaugc   u
        uacuuuuau     a          g         a  -  a  aag      uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 2882790-2882901 [+]
intergenic
Database links

Mature sequence sly-miR171d

Accession MIMAT0007925
Sequence

75 - 

uugagccgcgccaauaucac

 - 94

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).