Stem-loop sequence sly-MIR395a

AccessionMI0008369 (change log)
DescriptionSolanum lycopersicum miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

12 open access papers mention sly-MIR395a
(46 sentences)

Stem-loop
          ---  --uuu       ga   -    c       u ug          -c    ugacuuugaaaauuacgcaaacaaguauauauaaaugcaug 
5' agggcuu   ac     gauguug  agc cuug ugaagug u  ggggaacucc  gggu                                         a
   |||||||   ||     |||||||  ||| |||| ||||||| |  ||||||||||  ||||                                         g
3' uccugaa   ug     uuauaau  ucg gagu acuucac a  ucccuugagg  ucca                                         u
          guu  uuagu       --   a    -       c gu          uu    uguacuuaguuauaacaugaguaguagaaaucgauuaugca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr5: 1703152-1703350 [+]
intergenic
Database links

Mature sequence sly-miR395a

Accession MIMAT0007926
Sequence

29 - 

cugaaguguuugggggaacucc

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).