Stem-loop sequence sly-MIR395b

AccessionMI0008370 (change log)
DescriptionSolanum lycopersicum miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

10 open access papers mention sly-MIR395b
(33 sentences)

Stem-loop
   u      guu   ua         ug c       ug  g    a  uug 
5'  uaaggu   ccc  gaguucccu  a cacuuca  ag gcuu cu   a
    ||||||   |||  |||||||||  | |||||||  || |||| ||    
3'  auuuca   ggg  cucaagggg  u gugaagu  uu cgaa ga   u
   a      guu   uc         gu u       cg  g    -  uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr5: 1713691-1713791 [+]
intergenic
Database links

Mature sequence sly-miR395b

Accession MIMAT0007927
Sequence

66 - 

cugaaguguuugggggaacucc

 - 87

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).