Stem-loop sequence xla-mir-1b

AccessionMI0008372 (change log)
DescriptionXenopus laevis miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention xla-mir-1b
(2 sentences)

Stem-loop
   --          u    gc     - ugaa 
5'   cauacuucuu auau  ccaua c    u
     |||||||||| ||||  ||||| |    g
3'   guaugaagaa ugua  gguau g    c
   au          u    -a     c uaac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr2L: 65219815-65219873 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-1b
xla-mir-1bchr2L: 65219815-65219873 [-]
xla-mir-133dchr2L: 65219390-65219464 [-]
Database links

Mature sequence xla-miR-1b

Accession MIMAT0011135
Sequence

39 - 

uggaauguuaagaaguaugua

 - 59

Get sequence
Evidence by similarity; MI0004890

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).