Stem-loop sequence xla-mir-133b

AccessionMI0008375
DescriptionXenopus laevis miR-133b stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --    u         ca  c  a      u  g   u 
5'   cugc auggcuggu  aa gg accaag cc ucu c
     |||| |||||||||  || || |||||| || ||| c
3'   gacg uaucgacca  uu cc ugguuu gg aga u
   au    u         ac  c  c      -  -   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-133b

Accession MIMAT0011137
Sequence

47 - 

uugguccccuucaaccagcua

 - 67

Get sequence
Evidence by similarity; MI0004837

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).