Stem-loop sequence xla-mir-133b

AccessionMI0008375 (change log)
DescriptionXenopus laevis miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention xla-mir-133b
(5 sentences)

Stem-loop
   --    u         ca  c  a      u  g   u 
5'   cugc auggcuggu  aa gg accaag cc ucu c
     |||| |||||||||  || || |||||| || ||| c
3'   gacg uaucgacca  uu cc ugguuu gg aga u
   au    u         ac  c  c      -  -   u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr5S: 131151096-131151170 [+]
intergenic
chr5L: 152012861-152012935 [+]
intergenic
Database links

Mature sequence xla-miR-133b

Accession MIMAT0011137
Sequence

47 - 

uugguccccuucaaccagcua

 - 67

Get sequence
Evidence by similarity; MI0004837

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).