Stem-loop sequence xla-mir-133d

AccessionMI0008376 (change log)
DescriptionXenopus laevis miR-133d stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention xla-mir-133d
(3 sentences)

Stem-loop
   - ug      -     -   aa   a   c   aaccc 
5'  c  guugcg cuggu gaa  gga cca auc     a
    |  |||||| ||||| |||  ||| ||| |||     g
3'  g  caacgc gacca cuu  ccu ggu uag     c
   c gu      c     a   cc   -   u   gaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr2L: 65219390-65219464 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-133d
xla-mir-1bchr2L: 65219815-65219873 [-]
xla-mir-133dchr2L: 65219390-65219464 [-]
Database links

Mature sequence xla-miR-133d

Accession MIMAT0011138
Sequence

47 - 

uugguccccuucaaccagccgc

 - 68

Get sequence
Evidence by similarity; MI0004836

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).