Stem-loop sequence xla-mir-142

AccessionMI0008377 (change log)
DescriptionXenopus laevis miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   --       gc  c           a         u  aca ga 
5'   cagugca  ca ccauaaaguag aagcacuac ag   g  c
     |||||||  || ||||||||||| ||||||||| ||   |  u
3'   gucaugu  gu gguauuucauc uuugugaug uc   c  g
   gg       ga  a           c         -  --g aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
Sc000035_chr2L: 283175-283260 [+]
intergenic
Database links

Mature sequence xla-miR-142

Accession MIMAT0011139
Sequence

14 - 

cauaaaguagaaagcacuac

 - 33

Get sequence
Evidence by similarity; MI0004842

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).