Stem-loop sequence xla-mir-15c

AccessionMI0008378 (change log)
DescriptionXenopus laevis miR-15c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   cuuugaggugaucua     a  uc          gaaac 
5'                gcagc ca  augguuugua     a
                  ||||| ||  ||||||||||      
3'                cgucg gu  uaccagacau     a
   --------aguucuc     a  cu          agagg 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48901002-48901075 [-]
intergenic
Database links

Mature sequence xla-miR-15c

Accession MIMAT0011140
Sequence

14 - 

uagcagcacaucaugguuugua

 - 35

Get sequence
Evidence by similarity; MI0004892

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).