Stem-loop sequence xla-mir-194

AccessionMI0008379 (change log)
DescriptionXenopus laevis miR-194 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   uagugug       u         a      g    cuug 
5'        uaucagg guaacagca cuccau ugga    u
          ||||||| ||||||||| |||||| ||||     
3'        guaguuu cauugucgu gaggug accu    c
   -----ag       u         a      -    uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr5L: 11202163-11202238 [+]
intergenic
Database links

Mature sequence xla-miR-194

Accession MIMAT0011141
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence by similarity; MI0004857

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).