Stem-loop sequence xla-mir-205

AccessionMI0008380
DescriptionXenopus laevis miR-205 stem-loop
Gene family MIPF0000058; mir-205
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that -- by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2-- Mir-205 is involved in epithelial to mesenchymal transition (EMT) and tumor invasion[citation needed]. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. The cause of miR-200 silencing in naturally-occurring cancer cells, however, remains largely unknown.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cc     u   gc   c        c  c        ucuca 
5'   acgug ccu  ugu cuucauuc ac ggagucug     u
     ||||| |||  ||| |||||||| || ||||||||     a
3'   uguac gga  aca gaagugag ug cuuuagac     c
   ga     -   ga   c        a  a        uaaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-205

Accession MIMAT0011142
Sequence

16 - 

uccuucauuccaccggagucug

 - 37

Get sequence
Evidence by similarity; MI0004950

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).