Stem-loop sequence xla-mir-205

AccessionMI0008380 (change log)
DescriptionXenopus laevis miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   cc     u   gc   c        c  c        ucuca 
5'   acgug ccu  ugu cuucauuc ac ggagucug     u
     ||||| |||  ||| |||||||| || ||||||||     a
3'   uguac gga  aca gaagugag ug cuuuagac     c
   ga     -   ga   c        a  a        uaaua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr2S: 39311522-39311607 [-]
intergenic
Database links

Mature sequence xla-miR-205

Accession MIMAT0011142
Sequence

16 - 

uccuucauuccaccggagucug

 - 37

Get sequence
Evidence by similarity; MI0004950

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).