Stem-loop sequence xla-mir-223

AccessionMI0008382
DescriptionXenopus laevis miR-223 stem-loop
Gene family MIPF0000067; mir-223
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-223. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology MicroRNA-223 (miR-223) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-223 is a hematopoietic specific microRNA with crucial functions in myeloid lineage development. It plays an essential role in promoting granulocytic differentiation while also being associated with the suppression of erythrocytic differentiation. miR-223 is commonly repressed in hepatocellular carcinoma and leukemia. Higher expression levels of miRNA-223 are associated with extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach and recurrent ovarian cancer. In some cancers the microRNA-223 down-regulation is correlated with higher tumor burden, disease aggressiveness, and poor prognostic factors. MicroRNA-223 is also associated with rheumatoid arthritis, sepsis, type 2 diabetes, and hepatic ischemia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    gg    ga u              gagucc       a u 
5'  gugu  cacu  g guauuugacaagcu      gacacuc g g
    ||||  ||||  | ||||||||||||||      ||||||| | a
3'  cacg  guga  c cauaaacuguuuga      cugugag c g
   -    ga    ac c              ------       a a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-223

Accession MIMAT0011144
Sequence

55 - 

ugucaguuugucaaauacccc

 - 75

Get sequence
Evidence by similarity; MI0004875

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).