Stem-loop sequence xla-mir-223

AccessionMI0008382 (change log)
DescriptionXenopus laevis miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   u    gg    ga u              gagucc       a u 
5'  gugu  cacu  g guauuugacaagcu      gacacuc g g
    ||||  ||||  | ||||||||||||||      ||||||| | a
3'  cacg  guga  c cauaaacuguuuga      cugugag c g
   -    ga    ac c              ------       a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 19109665-19109750 [-]
intergenic
Database links

Mature sequence xla-miR-223

Accession MIMAT0011144
Sequence

55 - 

ugucaguuugucaaauacccc

 - 75

Get sequence
Evidence by similarity; MI0004875

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).