Stem-loop sequence xla-mir-23a

AccessionMI0008383
DescriptionXenopus laevis miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cc     cg  gg        ag   g     uauuu   c 
5'   gacag  gg  auuccugg  aug gauuu     uug a
     |||||  ||  ||||||||  ||| |||||     |||  
3'   cuguc  cc  uagggacc  uac cuaaa     aac g
   --     aa  uu        gu   a     ----u   c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-23a

Accession MIMAT0011145
Sequence

51 - 

aucacauugccagggauuucc

 - 71

Get sequence
Evidence by similarity; MI0004894

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).