Stem-loop sequence xla-mir-23a

AccessionMI0008383 (change log)
DescriptionXenopus laevis miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cc     cg  gg        ag   g     uauuu   c 
5'   gacag  gg  auuccugg  aug gauuu     uug a
     |||||  ||  ||||||||  ||| |||||     |||  
3'   cuguc  cc  uagggacc  uac cuaaa     aac g
   --     aa  uu        gu   a     ----u   c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr3L: 127493447-127493524 [+]
intergenic
Clustered miRNAs
< 10kb from xla-mir-23a
xla-mir-23achr3L: 127493447-127493524 [+]
xla-mir-27achr3L: 127494213-127494272 [+]
xla-mir-24b-1chr3L: 127494340-127494407 [+]
Database links

Mature sequence xla-miR-23a

Accession MIMAT0011145
Sequence

51 - 

aucacauugccagggauuucc

 - 71

Get sequence
Evidence by similarity; MI0004894

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).