Stem-loop sequence xla-mir-363

AccessionMI0008385 (change log)
DescriptionXenopus laevis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Literature search

1 open access papers mention xla-mir-363
(7 sentences)

Stem-loop
   u     u   cg         ca  a         a   aagu 
5'  uuugu guu  cggguggau  cg ugcaauuuu uuu    u
    ||||| |||  |||||||||  || ||||||||| |||    u
3'  agacg caa  gucuaccua  gc acguuaaaa gag    g
   a     c   au         ug  -         a   gaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48821690-48821777 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-363
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-363

Accession MIMAT0011147
Sequence

13 - 

cggguggaucacgaugcaauuu

 - 34

Get sequence
Evidence by similarity; MI0004955

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).