Stem-loop sequence xla-mir-363

AccessionMI0008385
DescriptionXenopus laevis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u     u   cg         ca  a         a   aagu 
5'  uuugu guu  cggguggau  cg ugcaauuuu uuu    u
    ||||| |||  |||||||||  || ||||||||| |||    u
3'  agacg caa  gucuaccua  gc acguuaaaa gag    g
   a     c   au         ug  -         a   gaug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-363

Accession MIMAT0011147
Sequence

13 - 

cggguggaucacgaugcaauuu

 - 34

Get sequence
Evidence by similarity; MI0004955

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).