Stem-loop sequence xla-mir-703

AccessionMI0008386
DescriptionXenopus laevis miR-703 stem-loop
Gene family MIPF0000761; mir-703
Stem-loop
   ag       aa   u   -    caucg      cu   g --a          uug 
5'   acugguu  uga aac aaug     uaaaac  uca a   ggaaagaaug   u
     |||||||  ||| ||| ||||     ||||||  ||| |   ||||||||||    
3'   ugacuaa  acu uug uuau     auuuug  ggu u   uuuuuuuuac   g
   --       -a   u   a    --uga      ac   g gug          cag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence xla-miR-703

Accession MIMAT0011148
Sequence

29 - 

aaaaccuucagaaggaaagaa

 - 49

Get sequence
Evidence by similarity; MI0004687

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).