Stem-loop sequence xla-mir-92a-1

AccessionMI0008388 (change log)
DescriptionXenopus laevis miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention xla-mir-92a-1
(2 sentences)

Stem-loop
   cu     u            u   u           cu 
5'   uucug auagguugggau ggu gcaaugcugua  a
     ||||| |||||||||||| ||| |||||||||||  u
3'   aggau uguccggcccug uca cguuaugaugu  u
   gu     u            u   -           au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr2L: 107331786-107331863 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-92a-1
xla-mir-17-2chr2L: 107332477-107332538 [-]
xla-mir-18bchr2L: 107332346-107332408 [-]
xla-mir-19achr2L: 107332210-107332271 [-]
xla-mir-20achr2L: 107332044-107332104 [-]
xla-mir-92a-1chr2L: 107331786-107331863 [-]
Database links

Mature sequence xla-miR-92a-3p

Accession MIMAT0011149
Sequence

49 - 

uauugcacuugucccggccugu

 - 70

Get sequence
Evidence by similarity; MI0003106

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).