Stem-loop sequence xla-mir-92a-2

AccessionMI0008389 (change log)
DescriptionXenopus laevis miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention xla-mir-92a-2
(2 sentences)

Stem-loop
     c    ug   g     uu  u   c     -gu  u 
5' uc ucug  ggu gggau  gu gca uacuu   gu u
   || ||||  ||| |||||  || ||| |||||   ||  
3' ag aggu  ccg cccug  ca cgu augaa   ua u
     u    gu   g     uu  -   u     aau  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48821825-48821900 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-92a-2
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-92a-3p

Accession MIMAT0011149
Sequence

49 - 

uauugcacuugucccggccugu

 - 70

Get sequence
Evidence by similarity; MI0003106

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).