Stem-loop sequence ptr-let-7a-1

AccessionMI0008397 (change log)
DescriptionPan troglodytes let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention ptr-let-7a-1
(24 sentences)

Stem-loop
   -    u   gu                uuagggucacac 
5'  ggga gag  aguagguuguauaguu            c
    |||| |||  ||||||||||||||||            c
3'  uccu uuc  ucaucuaacauaucaa            a
   a    -   ug                uagagggucacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 71912745-71912823 [+]
sense
ENSPTRT00000054514 ; ptr-let-7a-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7a-1
ptr-let-7a-1chr9: 71912745-71912823 [+]
ptr-let-7f-1chr9: 71913135-71913220 [+]
ptr-let-7dchr9: 71915622-71915707 [+]
Database links

Mature sequence ptr-let-7a

Accession MIMAT0007936
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Evidence by similarity; MI0000062
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).