Stem-loop sequence ptr-let-7a-2

AccessionMI0008398 (change log)
DescriptionPan troglodytes let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention ptr-let-7a-2
(24 sentences)

Stem-loop
   a  uu   g   u             uagaa ua a 
5'  gg  gag uag agguuguauaguu     u  c u
    ||  ||| ||| |||||||||||||     |  | c
3'  cc  uuc auc uccgacaugucaa     a  g a
   -  -u   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 122642010-122642080 [-]
sense
ENSPTRT00000054386 ; ptr-let-7a-2-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7a-2
ptr-mir-100chr11: 122647706-122647785 [-]
ptr-let-7a-2chr11: 122642010-122642080 [-]
Database links

Mature sequence ptr-let-7a

Accession MIMAT0007936
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Evidence by similarity; MI0000062
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).